View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15133_low_27 (Length: 243)
Name: NF15133_low_27
Description: NF15133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15133_low_27 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 18 - 224
Target Start/End: Original strand, 39633645 - 39633851
Alignment:
| Q |
18 |
ggaagtgcagggaaaggcaccaaaactgattggatgatgcatgaatttcgtctaccacctaaaggaaaaactagcaataatcaagctcttaatcatacca |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
39633645 |
ggaagtgcagggaaaggcaccaaaactgattggatgatgcatgaatttcgtctaccacctaaaggaaaaactagcaataatcaagttcttaaccatacca |
39633744 |
T |
 |
| Q |
118 |
atgatattcaagaagctgtaagtgatttattgtgtttgcatttttatcaaaactttcattatttttgtgtttatattaaggggtgtttgaactttactta |
217 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
39633745 |
atgatgttcaagaagctgtaagtcatttattgtatttgcatttttatcaaaactttcattatttttgtgtttatattaaggggtgtttgaacttcactta |
39633844 |
T |
 |
| Q |
218 |
tcatata |
224 |
Q |
| |
|
||||||| |
|
|
| T |
39633845 |
tcatata |
39633851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 21 - 70
Target Start/End: Original strand, 28614840 - 28614889
Alignment:
| Q |
21 |
agtgcagggaaaggcaccaaaactgattggatgatgcatgaatttcgtct |
70 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
28614840 |
agtgccggaaaaggcaccaaaactgattggatgatgcatgagtttcgtct |
28614889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 21 - 70
Target Start/End: Original strand, 28629365 - 28629414
Alignment:
| Q |
21 |
agtgcagggaaaggcaccaaaactgattggatgatgcatgaatttcgtct |
70 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
28629365 |
agtgccggaaaaggcaccaaaactgattggatgatgcatgagtttcgtct |
28629414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University