View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15133_low_30 (Length: 239)
Name: NF15133_low_30
Description: NF15133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15133_low_30 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 15 - 221
Target Start/End: Original strand, 28669013 - 28669221
Alignment:
| Q |
15 |
aagaagtgtaagataaaaacatgcacagtttgagtttcacatacacaatttcaaaaaacaaactttgaactg--nnnnnnnctctctctctagaaatgct |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
28669013 |
aagaagtgtaagataaaaacatgcacagtttgagtttcacatacacaatttcaaaaaacaaactttgaactgtttttttctctctctctctagaaatgct |
28669112 |
T |
 |
| Q |
113 |
aagataatgaatgtgtcagggttgttgtctcacaaagattctctctgtnnnnnnntgtgttatttttctctgtcaacaacggcaaagacacgtttgatga |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28669113 |
aagataatgaatgtgtcagggttgttgtctcacaaagattctctctgtaaaaaaatgtgttatttttctctgtcaacaacggcaaagacacgtttgatga |
28669212 |
T |
 |
| Q |
213 |
taatctaac |
221 |
Q |
| |
|
||||||||| |
|
|
| T |
28669213 |
taatctaac |
28669221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University