View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15133_low_33 (Length: 233)
Name: NF15133_low_33
Description: NF15133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15133_low_33 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 13 - 233
Target Start/End: Complemental strand, 40221449 - 40221229
Alignment:
| Q |
13 |
agcacaagtggacatgacaaacaagaatctcacaggttctgcttctaccaccatctcaagatcttgtcccttaaaaccattcacaaattctgctgcattg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40221449 |
agcacaagtggacatgacaaacaagaatctcacacgttctgcttctaccaccatctcaagatcttgtcccttaaaaccattcacaaattctgctgcattg |
40221350 |
T |
|
| Q |
113 |
ccatctacttgttgtgctgctgctaaagtacaagctgaagaacaaatcatgttactggcaacaaggacacaaagttgcattgactccgtttcaagattct |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40221349 |
ccatctacttgttgtgctgctgctaaagtacaagctgaagaacaaatcatgttactggcaacaaggacacaaagttgcattgactccgtttcaagattct |
40221250 |
T |
|
| Q |
213 |
tgtagtagagacagggatttt |
233 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
40221249 |
tgtagtagagacagggatttt |
40221229 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University