View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15134_high_13 (Length: 209)
Name: NF15134_high_13
Description: NF15134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15134_high_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 20 - 199
Target Start/End: Complemental strand, 6899188 - 6899009
Alignment:
| Q |
20 |
tataggtcaagtttctcttagtgtgccagtacggatgcttttgggaggtattctgctatccacttacgccatttctagcaaaacccaatgnnnnnnnnac |
119 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||| || |
|
|
| T |
6899188 |
tatagatcaagtttctcttagtgtgccagtacggatacttttgggaggtattctggtatccacttacgccatttctagcaaaacccaatgttttttttac |
6899089 |
T |
|
| Q |
120 |
caagaactatgagatacactctcaaccttggcataagcctcttcaaattccagtttgaacaagattggtttcttctctct |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6899088 |
caagaactatgagatacactctcaaccttggcataagcctcttcaaattccagtttgaacaagattggtttcttctctct |
6899009 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University