View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15134_low_11 (Length: 314)
Name: NF15134_low_11
Description: NF15134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15134_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 3445267 - 3445555
Alignment:
| Q |
18 |
atcgtttatgaacgttgataagatccttcgatctggcacagatcatcaattgggttggtttatgtcattttaatctttcttgttgtcttctgagtttaga |
117 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
3445267 |
atcgtttatggacgttgataagatccttcgatctggcacagatcatcaattgggttggtttatgtcattttaatctttcttgttgtcttttgagtttaga |
3445366 |
T |
 |
| Q |
118 |
tgcatcatcatcacaaatttgcagtaggattcacgtgaatcagataatattattaatgttttagatatggtttttgttatgatgtatcttatcaacatga |
217 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
3445367 |
tacatcatcatcacaaatttgcagtaggattcacgtgaatcagataatattattaatgttttagatatggtttttgttatgatgtatgttatcaacatga |
3445466 |
T |
 |
| Q |
218 |
tgttgcatgtgtggattatgtcacaaaacatcctttgccatctctttcatgaatctggtttgtgaaggattcttaatgttctttgaatct |
307 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3445467 |
tgttgcatgtgt-gattatgtcacaaaacatcctttgccatctctttcatgaatctggtttgtgaaggattcttaatgttctttgaatct |
3445555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University