View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15134_low_15 (Length: 220)
Name: NF15134_low_15
Description: NF15134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15134_low_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 4e-96; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 31 - 212
Target Start/End: Complemental strand, 10603945 - 10603764
Alignment:
| Q |
31 |
taaatcatagcaataagaaaatatagttaatggtgcatcacgacatgtaacttggtcacttgagtttatcaggttttgaatgtttctgcgttgacaattg |
130 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10603945 |
taaatcatggcaataagaaaatatagttaatggtgcatcacgacatgtaacttggtcacttgagtttatcaggttttgaatgtttctgcgttgacaattg |
10603846 |
T |
|
| Q |
131 |
acataactagcttacacatgcagacaaccttatttgtcattttctagcaaacataagtttcatagttgacctgccctttgct |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10603845 |
acataactagcttacacatgcagacaaccttatttgtcattttctagcaaacataagtttcatagttgacctgccctttgct |
10603764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 31 - 118
Target Start/End: Complemental strand, 10612064 - 10611977
Alignment:
| Q |
31 |
taaatcatagcaataagaaaatatagttaatggtgcatcacgacatgtaacttggtcacttgagtttatcaggttttgaatgtttctg |
118 |
Q |
| |
|
|||| ||| ||||||| |||||||| ||||||||||||| ||||| |||||||| |||| ||||||||||||| |||||||||||| |
|
|
| T |
10612064 |
taaaccatggcaataaacaaatatagataatggtgcatcattacatgaaacttggttacttaagtttatcaggttctgaatgtttctg |
10611977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University