View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15135_high_17 (Length: 258)
Name: NF15135_high_17
Description: NF15135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15135_high_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 106; Significance: 4e-53; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 137 - 250
Target Start/End: Complemental strand, 49223497 - 49223384
Alignment:
| Q |
137 |
ccaccatattttaagaccttattctcattgatattaattgtttttatcaaattgcaattaatttgacatttataatgttcaataatcacagatattttgt |
236 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49223497 |
ccaccatattttaagaccttgttctcattgatattaattgtttttatcaacttgcaattaatttgacatttataatgttcaataatcacagatattttgt |
49223398 |
T |
 |
| Q |
237 |
ggctgcattctctg |
250 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
49223397 |
ggctgcattctctg |
49223384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University