View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15135_high_19 (Length: 231)
Name: NF15135_high_19
Description: NF15135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15135_high_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 25 - 225
Target Start/End: Complemental strand, 55356359 - 55356165
Alignment:
| Q |
25 |
ggtatgaaagcaagaaatgttcaatttggatggaaagcagcattgtattgtataaaataatataatatgaaaccaagttttagggatggataatgagaaa |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
55356359 |
ggtatgaaagcaagaaatgttcaatttggatggaaagcagcattgtattgtataa-----tataatatgaaaccaagttttagggatgg-taatgagaaa |
55356266 |
T |
|
| Q |
125 |
aatacctgactagaaatataaccacagcgttcacaaattccctgttcaggcattttggtagtcgtagaaatcctgaaattctcccctgatttgatgatgt |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55356265 |
aatacctgactagaaatataaccacagcgttcacaaaatccctgttcaggcattttggtggtcgtagaaatcctgaaattctcccctgatttgatgatgt |
55356166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University