View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15135_high_23 (Length: 205)
Name: NF15135_high_23
Description: NF15135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15135_high_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 133; Significance: 2e-69; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 11 - 191
Target Start/End: Original strand, 28861319 - 28861498
Alignment:
| Q |
11 |
agtgaaaagaatcaacggttcttttggagtggttatcacatacattttctctcttccctctttttgaatgatctggttctggttgatcggtttggaaaag |
110 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
28861319 |
agtgaaaataatcaacggttcatttggagtggttatcacataccttttctctctcccctctttttgaatgatctggttctggttgatcggattgtaaaag |
28861418 |
T |
 |
| Q |
111 |
caggaggattgttgatgctttggaaacttgtgttgcctcttggttggaagcttctccttagttttgaacaggtactttttg |
191 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||| |||||||| |||| ||||| |
|
|
| T |
28861419 |
caggaggattgttgatgctttggagatttgtgttgcctcttggttggaagcttctccttag-tttgaacatgtacattttg |
28861498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 92 - 191
Target Start/End: Original strand, 28859377 - 28859476
Alignment:
| Q |
92 |
gttgatcggtttggaaaagcaggaggattgttgatgctttggaaacttgtgttgcctcttggttggaagcttctccttagttttgaacaggtactttttg |
191 |
Q |
| |
|
||||||||||||||| ||||||||| ||| || |||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
28859377 |
gttgatcggtttggagaagcaggagaattttttatgctttggagacttgtgttgcctcttggttggaagcttctccttgattttgaacaggtactttttg |
28859476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 141 - 174
Target Start/End: Complemental strand, 2768198 - 2768165
Alignment:
| Q |
141 |
tgttgcctcttggttggaagcttctccttagttt |
174 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |
|
|
| T |
2768198 |
tgttgcctcttggttggaagcttcttcttagttt |
2768165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University