View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15135_low_17 (Length: 274)
Name: NF15135_low_17
Description: NF15135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15135_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 85 - 205
Target Start/End: Original strand, 25226353 - 25226473
Alignment:
| Q |
85 |
tctctctcatgagaaagttagttacgatccataaccgtttccgcaatttatgcttgttcttcaagcttttccagttttcgtttttcccttgttttcttga |
184 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| ||||| | ||| |||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
25226353 |
tctctctcatgagagagttagttacgatccataattgtttctgtcattgatgcttgttcttcaagcttttccagttttcgtttttccgttgttttcttga |
25226452 |
T |
|
| Q |
185 |
agattccatgtgattcttctt |
205 |
Q |
| |
|
||||||| ||||||||||||| |
|
|
| T |
25226453 |
agattccttgtgattcttctt |
25226473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 20 - 90
Target Start/End: Original strand, 24733804 - 24733874
Alignment:
| Q |
20 |
ttctttcatcaataatatgattctatttctgttattcataatatggtatcagttttattttgctttctctc |
90 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24733804 |
ttctttcatcaataatatgattctatttctgttattcataatatggtatcagttttattttgctttctctc |
24733874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University