View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15135_low_21 (Length: 227)
Name: NF15135_low_21
Description: NF15135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15135_low_21 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 24 - 210
Target Start/End: Original strand, 25777936 - 25778122
Alignment:
| Q |
24 |
gcgacttcgttcttgcaaaaaacagtttggttagcccctctttgtgatattgaggtgggagggatatttggtttacacaaagcgttagaataggttttag |
123 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25777936 |
gcgacttcgttcttgcaaaaaacagtctggttagcccctctttgtgatatcgaggtgggagggatatttggtttacacaaagcgttagaataggttttag |
25778035 |
T |
|
| Q |
124 |
accatcagtttgacaacgtagattttgctctagactgtaagatcatttatcaatttagaacattgtgtatttcgttgtattatatct |
210 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
25778036 |
accatcagttcgacaatgtagattttgctctagactgtaagatcatttatcaatttagaacgttgtgtatttcgttgtattatatct |
25778122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University