View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15136_high_5 (Length: 230)
Name: NF15136_high_5
Description: NF15136
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15136_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 206; Significance: 1e-113; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 4 - 213
Target Start/End: Complemental strand, 44751066 - 44750857
Alignment:
| Q |
4 |
caaaccatgttcatcgagtttgggtggttgatcaagagggtttgcttgttggtgttgtgtctctcactgatgtaatcagagttataaggcaatctatgtt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44751066 |
caaaccatgttcatcgagtttgggtggttgatcaagagggtttgcttgttggtgttgtgtctctcactgatgtaatcagagttataaggcaatctatgtt |
44750967 |
T |
 |
| Q |
104 |
atcagatgcagatgcatgaatgtgtatgatacaagcaacaatgtgtgctatcttggagaaaatattgcagctatatgatcaatgttttgtttagtcaata |
203 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44750966 |
atcagatgcagatgcatgaatgtgtacgatacaagcaacaatgtgtgctatcttggagaaaatattgcagctatatgatcaatgttttgtttagtcaata |
44750867 |
T |
 |
| Q |
204 |
tgtacagtct |
213 |
Q |
| |
|
|||||||||| |
|
|
| T |
44750866 |
tgtacagtct |
44750857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 4 - 107
Target Start/End: Complemental strand, 44744426 - 44744323
Alignment:
| Q |
4 |
caaaccatgttcatcgagtttgggtggttgatcaagagggtttgcttgttggtgttgtgtctctcactgatgtaatcagagttataaggcaatctatgtt |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || ||||||||||||||||| ||||| |
|
|
| T |
44744426 |
caaaccatgttcatcgagtttgggtggttgatcaagagggtttgcttgtaggtgttgtgtctctcactgatgtcattagagttataaggcaatcaatgtt |
44744327 |
T |
 |
| Q |
104 |
atca |
107 |
Q |
| |
|
|||| |
|
|
| T |
44744326 |
atca |
44744323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University