View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15136_high_6 (Length: 221)
Name: NF15136_high_6
Description: NF15136
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15136_high_6 |
 | |
|
| [»] chr7 (5 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 146; Significance: 4e-77; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 19 - 221
Target Start/End: Original strand, 4921767 - 4921970
Alignment:
| Q |
19 |
tgataggattttgtgaccnnnnnnntgagaaaattctcgtgtataaaaaagatgaaatggtcaatggctctctccgtgatcacttatgttcaagggacac |
118 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4921767 |
tgataggattttgtgaccaaaaaaatgagaaaattctcgtgtataaaaaagatgaaatggtcaatggctctctccgtgatcacttatgttcaagggacac |
4921866 |
T |
|
| Q |
119 |
ggtttcactctcttgg-nnnnnnnggcttgaaatacgcattggagctgcaaaaggactacactaccttcacactggagcaaagcgcccgattttccaccg |
217 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4921867 |
ggtttcactctcttggaaaaaaaaggcttgaaatatgcattggagctgcaaaaggactgcactaccttcacactggagcaaagcgcccgattttccaccg |
4921966 |
T |
|
| Q |
218 |
tgac |
221 |
Q |
| |
|
|||| |
|
|
| T |
4921967 |
tgac |
4921970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 46 - 221
Target Start/End: Original strand, 4928036 - 4928211
Alignment:
| Q |
46 |
agaaaattctcgtgtataaaaaagatgaaatggtcaatggctctctccgtgatcacttatgttcaagggacacggtttcactctcttggnnnnnnnggct |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||| |||| ||||| | || |||||||| ||| |||| |
|
|
| T |
4928036 |
agaaaattctcgtgtataaaaaagatgaaatggtcaatggcactctccaagatcacttaggttcgagggatatggaatcactctcgtggaagaaaaggct |
4928135 |
T |
|
| Q |
146 |
tgaaatacgcattggagctgcaaaaggactacactaccttcacactggagcaaagcgcccgattttccaccgtgac |
221 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
4928136 |
tgaaatatgcattggagctgcaaaaggactacactatcttcacactggaacaaagcgtccgattttccaccgtgac |
4928211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 142 - 221
Target Start/End: Complemental strand, 4908084 - 4908005
Alignment:
| Q |
142 |
ggcttgaaatacgcattggagctgcaaaaggactacactaccttcacactggagcaaagcgcccgattttccaccgtgac |
221 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| ||| ||||| |
|
|
| T |
4908084 |
ggctagaaatatgcattggagctgcaaaaggactacactaccttcacactggagcaaagcgcgcaatttttcactgtgac |
4908005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 79 - 220
Target Start/End: Complemental strand, 4904223 - 4904082
Alignment:
| Q |
79 |
tcaatggctctctccgtgatcacttatgttcaagggacacggtttcactctcttggnnnnnnnggcttgaaatacgcattggagctgcaaaaggactaca |
178 |
Q |
| |
|
||||||| |||||| ||||||||||||||||||||| | |||||||| ||| ||||||||||| ||||||||| ||||| ||||||||| |
|
|
| T |
4904223 |
tcaatggttctctctatgatcacttatgttcaagggatctagaatcactctcatggaagaaaaggcttgaaatatgcattggagttgcaagaggactaca |
4904124 |
T |
|
| Q |
179 |
ctaccttcacactggagcaaagcgcccgattttccaccgtga |
220 |
Q |
| |
|
||| |||||||| |||||||||||| | ||||| ||| |||| |
|
|
| T |
4904123 |
ctatcttcacaccggagcaaagcgcgcaatttttcactgtga |
4904082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 142 - 203
Target Start/End: Original strand, 5822169 - 5822230
Alignment:
| Q |
142 |
ggcttgaaatacgcattggagctgcaaaaggactacactaccttcacactggagcaaagcgc |
203 |
Q |
| |
|
||||||||||| |||| |||||||| || |||||||||||||||||||||||| |||||||| |
|
|
| T |
5822169 |
ggcttgaaatatgcatcggagctgctaagggactacactaccttcacactggaacaaagcgc |
5822230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University