View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15136_low_7 (Length: 218)
Name: NF15136_low_7
Description: NF15136
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15136_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 17 - 202
Target Start/End: Complemental strand, 44622731 - 44622553
Alignment:
| Q |
17 |
cagagactctagaagatgtgcaaccttttttatttaacctttttgcagacccggtaatactctagctttagcttttacatactctacatttgaactgtan |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
44622731 |
cagagactctagaagatgtgcaaccttttttatttaacctttttgcagacccggtaatactctagcttt------tacatactctacatttgaactgtat |
44622638 |
T |
|
| Q |
117 |
nnnnnnacagtgttgtcaaatagtggcgctatagtgctatagtgtattgaaatattaaaaaattgctattatttatgcgtaatatg |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44622637 |
ttttt-acagtgttgtcaaatagtggcgctatagtgctttagtgtattgaaatattaaaaaattgctattatttatgcgtaatatg |
44622553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 17 - 84
Target Start/End: Complemental strand, 39878010 - 39877943
Alignment:
| Q |
17 |
cagagactctagaagatgtgcaaccttttttatttaacctttttgcagacccggtaatactctagctt |
84 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||||||||||||| || || ||||||||||||||| |
|
|
| T |
39878010 |
cagagactctagatgatgtgcagccttttttatttaacctttttgccgatccagtaatactctagctt |
39877943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 17 - 114
Target Start/End: Complemental strand, 24036067 - 24035976
Alignment:
| Q |
17 |
cagagactctagaagatgtgcaaccttttttatttaacctttttgcagacccggtaatactctagctttagcttttacatactctacatttgaactgt |
114 |
Q |
| |
|
|||||||||||||||||||| || |||| |||||| ||||||||| |||| |||||||||||||| ||| ||||| |||||||||||||||| |
|
|
| T |
24036067 |
cagagactctagaagatgtgaaatattttctatttaccctttttgctgacctggtaatactctagcatta------acatattctacatttgaactgt |
24035976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University