View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15137_low_7 (Length: 307)
Name: NF15137_low_7
Description: NF15137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15137_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 44 - 291
Target Start/End: Complemental strand, 18014161 - 18013907
Alignment:
| Q |
44 |
ggtcctaacgtttcctctttccattgctacacaatagttcattcttccacttcctgtccctcacgccggtgcccccgacgcctccttttcgtccatacag |
143 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18014161 |
ggtcccaacttttcctctttccattgctacacaatagtcccttcttccacttcctgtccctcacgccggtgcccccgacgcctccttttcgtccatacag |
18014062 |
T |
|
| Q |
144 |
aggcggcaccctc-------tcattcacattaattctcccaactcgcaagtctcaccattgcgatcatcaccttcaccctctcttcaaaggaagattgtc |
236 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
18014061 |
aggcggcaccctcctccttctcattcacattaattctcccaactcgcaagtctcaccattgcgatcatcaccttcaccctctcttcagaggaagattgtc |
18013962 |
T |
|
| Q |
237 |
agaccgccgtttcttgacggagcatcatctcttaattctcattggaggggacaac |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
18013961 |
agaccgccgtttcttgacggagcatcatctcttaattctcatcggaggggacaac |
18013907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University