View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15138_low_4 (Length: 213)
Name: NF15138_low_4
Description: NF15138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15138_low_4 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 161; Significance: 5e-86; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 36426457 - 36426669
Alignment:
| Q |
1 |
acaagggaaagtttaatccttttaaaattgagagagaannnnnnnnnngaatgaagcaaaatggagaaccaaagttgtatttatgtcttacttttatttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || |||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36426457 |
acaagggaaagtttaatccttttaaaattgagagataatttttttt--gaatgaagcaaaatagagaaccaaagttgtatttatgtcttacttttatttt |
36426554 |
T |
|
| Q |
101 |
agggttatttgtgttttagtccataaaatttgggctagtattgg--ttagtcccttgtatttttatatctttagattatgtgcatggtattcagcaggtt |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36426555 |
agggttatttgtgttttagtccataaaatttgggctagtattggttttagtcccttgtatttttatatctttagattatgtgcatggtattcagcaggtt |
36426654 |
T |
|
| Q |
199 |
tggatttgtttgact |
213 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
36426655 |
tggatttgtttgact |
36426669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 49 - 213
Target Start/End: Original strand, 36423700 - 36423866
Alignment:
| Q |
49 |
gaatgaagcaaaatggagaaccaaagttgtatttatgtcttacttttattttagggttatttgtgttttagtccataaaatttgggctagtattgg--tt |
146 |
Q |
| |
|
||||||| |||||| ||| ||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| || |
|
|
| T |
36423700 |
gaatgaaacaaaatagagtaccaaagctgtatttatgtcttacttttattttagggttatttgtgttttggtccataaaatttgggctagtattggtttt |
36423799 |
T |
|
| Q |
147 |
agtcccttgtatttttatatctttagattatgtgcatggtattcagcaggtttggatttgtttgact |
213 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36423800 |
agtcccttggaattttatatctttagattatgtgcatggtattcagcaggtttggatttgtttgact |
36423866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University