View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1513_low_6 (Length: 358)
Name: NF1513_low_6
Description: NF1513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1513_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 328; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 328; E-Value: 0
Query Start/End: Original strand, 15 - 342
Target Start/End: Original strand, 2861321 - 2861648
Alignment:
| Q |
15 |
acatacatccccatcgtcttagccttatcactagtcaacaaccttgacctcacaaccacactcatcttcacttcactctacaacatcaccaccggcctct |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2861321 |
acatacatccccatcgtcttagccttatcactagtcaacaaccttgacctcacaaccacactcatcttcacttcactctacaacatcaccaccggcctct |
2861420 |
T |
 |
| Q |
115 |
tcttcggtctgcctatgccagtccagcctatgaaatccattgcagcagttgccatctcagaatcaccacctctcaccattcctcaaatatctgcagctgg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2861421 |
tcttcggtctgcctatgccagtccagcctatgaaatccattgcagcagttgccatctcagaatcaccacctctcaccattcctcaaatatctgcagctgg |
2861520 |
T |
 |
| Q |
215 |
tttatgtgtagctgctgtccttctcgtgctcggtacaaccggtttaatgtcatttctttatcgttaccttcctcttccggttgttcgcggtgttcagctc |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2861521 |
tttatgtgtagctgctgtccttctcgtgctcggtacaaccggtttaatgtcatttctttatcgttaccttcctcttccggttgttcgcggtgttcagctc |
2861620 |
T |
 |
| Q |
315 |
tctcagggactccagttcgccttctctg |
342 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
2861621 |
tctcagggactccagttcgccttctctg |
2861648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University