View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15140_low_6 (Length: 266)
Name: NF15140_low_6
Description: NF15140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15140_low_6 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 16 - 266
Target Start/End: Original strand, 4706387 - 4706637
Alignment:
| Q |
16 |
aacttgccttgcgtcctacgacggatggctgcttgtctttcgccatgattcattgtttttcttttgccccttctctggagcaaaaatacaacttccgaat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4706387 |
aacttgccttgcgtcctacgacggatggctgcttgtctttcgccatgattcattgtttttcttttgccccttctctggagcaaaaatacaacttccgaat |
4706486 |
T |
|
| Q |
116 |
tgtccattgacaaaatcacatgactatattgcagcaatttcatctgctcccacatctcaggattgtattgttgtcgtgctcgatcgccccaatcattttc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4706487 |
tgtccattgacaaaatcacatgactatattgcagcaatttcatctgctcccacatctcaggattgtattgttgtcgtgctcgatcgccccaatcattttc |
4706586 |
T |
|
| Q |
216 |
aatttgaactgcacacactttgtcggggagaggatatatgggttaaatacc |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4706587 |
aatttgaactgcacacactttgtcggggagatgatatatgggttaaatacc |
4706637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University