View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15141_low_10 (Length: 313)
Name: NF15141_low_10
Description: NF15141
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15141_low_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 155; Significance: 3e-82; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 106 - 304
Target Start/End: Original strand, 22915467 - 22915665
Alignment:
| Q |
106 |
cttggttaattatttcttttcctttgnnnnnnnngtgtgtgcatattattttgaagaaacactgttttgaatatagtatatattggatatagtgagacga |
205 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
22915467 |
cttggttaattatttctttccctttgttttttttgtgtgtgcatattattttgaagaaacactatttcgaatatagtatatattggatatagtgagacga |
22915566 |
T |
 |
| Q |
206 |
ataaagttggatccctcgtttgtgtggttttgcttggctatatttgcctaaacaatatagagttaggctggttaaataaggttcacccttggttcattt |
304 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
22915567 |
ataaagttggatccctcttttgtgtggttttgcttggctatatttgcctaaacaatatagagttaggctggttaaataaggttcacccttagttcattt |
22915665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University