View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15141_low_14 (Length: 237)
Name: NF15141_low_14
Description: NF15141
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15141_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 1 - 138
Target Start/End: Original strand, 53602662 - 53602799
Alignment:
| Q |
1 |
cttatgaaggtcttaatgatgattttaaatctactttgtatgtatttaattgttggttatgaaaacaactcgtgaattaacttggtttgagagtgtagtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
53602662 |
cttatgaaggtcttaatgatgattttaaatctactttgtatgtatttaattgttggttatgaaaaaaactcgtgaattaacttggtttgagagtgtagtt |
53602761 |
T |
|
| Q |
101 |
ttggaagtgtttgaatgcatcgtttgctataccataat |
138 |
Q |
| |
|
|||| ||||||| | ||||||||||||||||||||||| |
|
|
| T |
53602762 |
ttggcagtgtttcattgcatcgtttgctataccataat |
53602799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 135 - 221
Target Start/End: Original strand, 53602852 - 53602938
Alignment:
| Q |
135 |
taatctacattcaacaaattattttttatgaatataaatatgttaagtttgttggcaactggggtaaacaatattattgtgaatttt |
221 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53602852 |
taatttacattcaacaaaatattttttatgaatataaatatgttaagtttgttggcaactggggtaaacaatattattgtgaatttt |
53602938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University