View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15141_low_15 (Length: 211)

Name: NF15141_low_15
Description: NF15141
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15141_low_15
NF15141_low_15
[»] chr3 (1 HSPs)
chr3 (35-194)||(3752308-3752467)
[»] chr7 (1 HSPs)
chr7 (156-194)||(26604316-26604354)
[»] chr4 (1 HSPs)
chr4 (140-193)||(25511169-25511221)
[»] chr1 (1 HSPs)
chr1 (140-193)||(31985453-31985505)


Alignment Details
Target: chr3 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 35 - 194
Target Start/End: Complemental strand, 3752467 - 3752308
Alignment:
35 accaacaccaaaccctagtagtgacaacactaacagtaacagcagcagcagtacaaagtgttttcagaattcagattgannnnnnncttgtcaaatgtat 134  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||    
3752467 accaacaccaaaccctagtagtgacaacactaacagtaacagcagcagcagtacaaagtgttttcagaattcagattgatttttttcttgtcaaatgtat 3752368  T
135 taggctctcctacttcttctatgagatttgtcttttctcttccatcttcatagatgaatg 194  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
3752367 taggctctcctacttcttctatgagatttgtcttttctcttccatcttcatcgatgaatg 3752308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 156 - 194
Target Start/End: Original strand, 26604316 - 26604354
Alignment:
156 tgagatttgtcttttctcttccatcttcatagatgaatg 194  Q
    |||||||||||||||||||||||||||||||| ||||||    
26604316 tgagatttgtcttttctcttccatcttcatagttgaatg 26604354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 140 - 193
Target Start/End: Original strand, 25511169 - 25511221
Alignment:
140 tctcctacttcttctatgagatttgtcttttctcttccatcttcatagatgaat 193  Q
    |||||| |||||| | |||||||||| ||||||||||||||||||||| |||||    
25511169 tctcctccttcttatctgagatttgt-ttttctcttccatcttcatagttgaat 25511221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 140 - 193
Target Start/End: Complemental strand, 31985505 - 31985453
Alignment:
140 tctcctacttcttctatgagatttgtcttttctcttccatcttcatagatgaat 193  Q
    |||||| |||||| | |||||||||| ||||||||||||||||||||| |||||    
31985505 tctcctccttcttatctgagatttgt-ttttctcttccatcttcatagttgaat 31985453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University