View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15141_low_15 (Length: 211)
Name: NF15141_low_15
Description: NF15141
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15141_low_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 35 - 194
Target Start/End: Complemental strand, 3752467 - 3752308
Alignment:
| Q |
35 |
accaacaccaaaccctagtagtgacaacactaacagtaacagcagcagcagtacaaagtgttttcagaattcagattgannnnnnncttgtcaaatgtat |
134 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3752467 |
accaacaccaaaccctagtagtgacaacactaacagtaacagcagcagcagtacaaagtgttttcagaattcagattgatttttttcttgtcaaatgtat |
3752368 |
T |
|
| Q |
135 |
taggctctcctacttcttctatgagatttgtcttttctcttccatcttcatagatgaatg |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
3752367 |
taggctctcctacttcttctatgagatttgtcttttctcttccatcttcatcgatgaatg |
3752308 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 156 - 194
Target Start/End: Original strand, 26604316 - 26604354
Alignment:
| Q |
156 |
tgagatttgtcttttctcttccatcttcatagatgaatg |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
26604316 |
tgagatttgtcttttctcttccatcttcatagttgaatg |
26604354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 140 - 193
Target Start/End: Original strand, 25511169 - 25511221
Alignment:
| Q |
140 |
tctcctacttcttctatgagatttgtcttttctcttccatcttcatagatgaat |
193 |
Q |
| |
|
|||||| |||||| | |||||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
25511169 |
tctcctccttcttatctgagatttgt-ttttctcttccatcttcatagttgaat |
25511221 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 140 - 193
Target Start/End: Complemental strand, 31985505 - 31985453
Alignment:
| Q |
140 |
tctcctacttcttctatgagatttgtcttttctcttccatcttcatagatgaat |
193 |
Q |
| |
|
|||||| |||||| | |||||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
31985505 |
tctcctccttcttatctgagatttgt-ttttctcttccatcttcatagttgaat |
31985453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University