View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15142_high_1 (Length: 419)
Name: NF15142_high_1
Description: NF15142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15142_high_1 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 4e-94; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 4e-94
Query Start/End: Original strand, 167 - 349
Target Start/End: Complemental strand, 12354567 - 12354385
Alignment:
| Q |
167 |
ttatgtcaaacttaaataaatacacttcaattcataatgcctattttgtagtttttataaaaaatttgcaagtaatttttatttatctcttgattgtttt |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12354567 |
ttatgtcaaacttaaataaatacacttcaattcataatgcctattttgtagtttttataaaaaatttgcaagtaatttttatttatctcttgattgtttt |
12354468 |
T |
 |
| Q |
267 |
ctatgattggttgattcatagatttagttgtatcatagatttgattgattcaattattaactatgattcattgtttgatcaat |
349 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
12354467 |
ctatgattggttgattcatagatttaattgtatcatagatttgattgattcaattattaactatgattcatagtttgatcaat |
12354385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 23 - 75
Target Start/End: Complemental strand, 12354682 - 12354630
Alignment:
| Q |
23 |
aaacattgctatgacccttacataagcaatggtagatttactttcactttatc |
75 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
12354682 |
aaacattgttatgacccttacataagcaatggtagatttactttcgctttatc |
12354630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 181 - 216
Target Start/End: Original strand, 12745681 - 12745716
Alignment:
| Q |
181 |
aataaatacacttcaattcataatgcctattttgta |
216 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |
|
|
| T |
12745681 |
aataaatacacttcaattcacaatgcctattttgta |
12745716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 170 - 226
Target Start/End: Complemental strand, 12399784 - 12399728
Alignment:
| Q |
170 |
tgtcaaacttaaataaatacacttcaattcataatgcctattttgtagtttttataa |
226 |
Q |
| |
|
|||||||||||||||||||| || |||||| |||||||| ||| || ||||||||| |
|
|
| T |
12399784 |
tgtcaaacttaaataaatacgttttaattcaaaatgcctactttctattttttataa |
12399728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University