View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15142_low_3 (Length: 237)
Name: NF15142_low_3
Description: NF15142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15142_low_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 18 - 220
Target Start/End: Complemental strand, 28604565 - 28604363
Alignment:
| Q |
18 |
atgtataagaattgcatctacatcttcttttgtacagcttgaagttctcatacccattaaatcagctccttcaatactagtatttttctcactttcatca |
117 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||| |||||||||||||||||||||| ||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
28604565 |
atgtataagaattgcatccacatcttctttagtacagtttgaagttctcatacccattaactcagctccttcaatactagaatttttctcactgtcatca |
28604466 |
T |
|
| Q |
118 |
tggctctttctatgtttgatgataaaaatctcttttttaacttgccctttatgtttttccactgaatcatcatcatgtttttctagtgctttcttcagct |
217 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28604465 |
tggctctttctgtgtttgatgataaaaatctcttttttaacttgccctttatgtttttctactgaatcatcatcatgtttttctagtgctttcttcagct |
28604366 |
T |
|
| Q |
218 |
tca |
220 |
Q |
| |
|
||| |
|
|
| T |
28604365 |
tca |
28604363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 110 - 155
Target Start/End: Complemental strand, 32425749 - 32425704
Alignment:
| Q |
110 |
tttcatcatggctctttctatgtttgatgataaaaatctctttttt |
155 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
32425749 |
tttcatcatggctttttctatgtttgatgataaaaatctctttttt |
32425704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 67
Target Start/End: Complemental strand, 32425930 - 32425888
Alignment:
| Q |
25 |
agaattgcatctacatcttcttttgtacagcttgaagttctca |
67 |
Q |
| |
|
||||||||||| || |||||||| ||||||||||||||||||| |
|
|
| T |
32425930 |
agaattgcatcaacttcttctttagtacagcttgaagttctca |
32425888 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University