View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15143_low_1 (Length: 280)
Name: NF15143_low_1
Description: NF15143
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15143_low_1 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 16 - 239
Target Start/End: Complemental strand, 48596110 - 48595887
Alignment:
| Q |
16 |
cttttgtcatcacataactctggctactgttccaataagaatacctgaaccgccacatcttaccatttcgatcttcaaaatttaggagaagccctttctc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48596110 |
cttttgtcatcacataactctggctactgttccaataagaatacctgaaccgccacatcttaccatttcgatcttcaaaatttaggagaagccctttctc |
48596011 |
T |
 |
| Q |
116 |
gttggtagaagaatccaaagggaagtacttctctgcgtgttgctttggaatcacaagtcgattcagtttccctacgtcactaggtgtcaccactttgtca |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
48596010 |
gttggtagaagaatccaaagggaagtacttctctgcgtgttgctttggaatcacaagtcgatttagtttccctacgtcactaggtgtcaccactttgtca |
48595911 |
T |
 |
| Q |
216 |
aacatatgctctttctctactact |
239 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
48595910 |
aacatatgctctttctctactact |
48595887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 16 - 115
Target Start/End: Original strand, 8775058 - 8775157
Alignment:
| Q |
16 |
cttttgtcatcacataactctggctactgttccaataagaatacctgaaccgccacatcttaccatttcgatcttcaaaatttaggagaagccctttctc |
115 |
Q |
| |
|
|||||||||| ||||| || |||||||||||||||||||| || || || | ||||| || ||||||| |||||||||||| || ||||| |||||||| |
|
|
| T |
8775058 |
cttttgtcataacatagctttggctactgttccaataagagtatctaaatctccacaattttccatttctatcttcaaaattcagaagaagacctttctc |
8775157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University