View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15144_low_7 (Length: 230)
Name: NF15144_low_7
Description: NF15144
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15144_low_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 22 - 229
Target Start/End: Original strand, 8842988 - 8843194
Alignment:
| Q |
22 |
cacgctcgcttctaaatcttcaaccatggtgctcgaggtaatttccgattannnnnnntctcgatttcaatttaccataacatgcatatttctaggnnnn |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8842988 |
cacgctcgcttctaaatcttcaaccatggtgctcgaggtaatttccgattacaccccctctcgatttcaatttaccataacatgcatatttctaggtttt |
8843087 |
T |
|
| Q |
122 |
nnnnaccgaattccttccttcaacaggcgactatgatctgtattgacaattctgaatggatgcgtaacggagattattctccttctcgatttcaagccca |
221 |
Q |
| |
|
||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
8843088 |
ttt-accgaattcttttcttcaacaggcgactatgatctgtattgacaattctgaatggatgcgtaacggagattattctccttctcgatttcaagctca |
8843186 |
T |
|
| Q |
222 |
agctgatg |
229 |
Q |
| |
|
|||||||| |
|
|
| T |
8843187 |
agctgatg |
8843194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 181 - 227
Target Start/End: Complemental strand, 31885711 - 31885665
Alignment:
| Q |
181 |
atgcgtaacggagattattctccttctcgatttcaagcccaagctga |
227 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||| ||| |||| |
|
|
| T |
31885711 |
atgcgtaacggtgattactctccttctcgatttcaagctcaatctga |
31885665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University