View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15145_high_21 (Length: 237)
Name: NF15145_high_21
Description: NF15145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15145_high_21 |
 | |
|
| [»] chr8 (10 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 221; Significance: 1e-122; HSPs: 10)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 17 - 237
Target Start/End: Complemental strand, 6370672 - 6370452
Alignment:
| Q |
17 |
atggattcttttgaaaatttgttactatgagtagaggattatcatgcatggatggctgatgaggaatttgcaagacagatgattgctggtgtgaatccga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6370672 |
atggattcttttgaaaatttgttactatgagtagaggattatcatgcatggatggctgatgaggaatttgcaagacagatgattgctggtgtgaatccga |
6370573 |
T |
|
| Q |
117 |
atgccatcgaaaaacttctggtaaatttgtaatatttttaagcatgtacaaaagaaataaagaaggttatcatttcaacttttcatatataatacataca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6370572 |
atgccatcgaaaaacttctggtaaatttgtaatatttttaagcatgtacaaaagaaataaagaaggttatcatttcaacttttcatatataatacataca |
6370473 |
T |
|
| Q |
217 |
tagtaatttgtaattaacctc |
237 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
6370472 |
tagtaatttgtaattaacctc |
6370452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 23 - 114
Target Start/End: Complemental strand, 6391576 - 6391485
Alignment:
| Q |
23 |
tcttttgaaaatttgttactatgagtagaggattatcatgcatggatggctgatgaggaatttgcaagacagatgattgctggtgtgaatcc |
114 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |||||||||| ||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6391576 |
tcttttgaaaatttcttactatgagtagaggatcgcactgcatggatgactgatgaggaatttgcaagggagatgattgctggtgtgaatcc |
6391485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 23 - 114
Target Start/End: Complemental strand, 6410738 - 6410647
Alignment:
| Q |
23 |
tcttttgaaaatttgttactatgagtagaggattatcatgcatggatggctgatgaggaatttgcaagacagatgattgctggtgtgaatcc |
114 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |||||||||| ||||||||||||| |||||| |||| ||||||||||||||||| |
|
|
| T |
6410738 |
tcttttgaaaatttcttactatgagtagaggatcgcactgcatggatgactgatgaggaattcgcaagagagataattgctggtgtgaatcc |
6410647 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 61 - 141
Target Start/End: Complemental strand, 7459713 - 7459633
Alignment:
| Q |
61 |
tgcatggatggctgatgaggaatttgcaagacagatgattgctggtgtgaatccgaatgccatcgaaaaacttctggtaaa |
141 |
Q |
| |
|
|||||||||| ||||||||||||| ||||| |||||||||||||| |||||||| || |||| |||||||||||||||| |
|
|
| T |
7459713 |
tgcatggatgactgatgaggaattcgcaaggcagatgattgctggggtgaatcctcatatcatcaaaaaacttctggtaaa |
7459633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 61 - 114
Target Start/End: Complemental strand, 6363729 - 6363676
Alignment:
| Q |
61 |
tgcatggatggctgatgaggaatttgcaagacagatgattgctggtgtgaatcc |
114 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
6363729 |
tgcatggatgactgatgaggaatttgcaagggagatgattgctggggtgaatcc |
6363676 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 64 - 114
Target Start/End: Complemental strand, 6289578 - 6289528
Alignment:
| Q |
64 |
atggatggctgatgaggaatttgcaagacagatgattgctggtgtgaatcc |
114 |
Q |
| |
|
||||||| ||||||| |||||| ||||| |||||||||||||||||||||| |
|
|
| T |
6289578 |
atggatgactgatgaagaatttacaagagagatgattgctggtgtgaatcc |
6289528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 65 - 114
Target Start/End: Complemental strand, 6321959 - 6321910
Alignment:
| Q |
65 |
tggatggctgatgaggaatttgcaagacagatgattgctggtgtgaatcc |
114 |
Q |
| |
|
|||||| ||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
6321959 |
tggatgactgatgaagaatttgcaagggagatgattgctggtgtgaatcc |
6321910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 61 - 114
Target Start/End: Complemental strand, 6332537 - 6332484
Alignment:
| Q |
61 |
tgcatggatggctgatgaggaatttgcaagacagatgattgctggtgtgaatcc |
114 |
Q |
| |
|
|||||||||| |||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
6332537 |
tgcatggatgactgatggagaatttgcaagggagatgattgctggtgtgaatcc |
6332484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 65 - 114
Target Start/End: Complemental strand, 6424616 - 6424567
Alignment:
| Q |
65 |
tggatggctgatgaggaatttgcaagacagatgattgctggtgtgaatcc |
114 |
Q |
| |
|
|||||| ||||||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
6424616 |
tggatgactgatgaggaatttgcaagggagatgattgctggagtgaatcc |
6424567 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 23 - 111
Target Start/End: Complemental strand, 6352962 - 6352874
Alignment:
| Q |
23 |
tcttttgaaaatttgttactatgagtagaggattatcatgcatggatggctgatgaggaatttgcaagacagatgattgctggtgtgaa |
111 |
Q |
| |
|
|||||||||||||| ||| ||||| || ||| || ||||||| | ||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
6352962 |
tcttttgaaaatttcttaatatgaacagtggaccattctgcatggcagactgatgaggaatttgcaagggagatgattgctggggtgaa |
6352874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 61 - 114
Target Start/End: Original strand, 36744663 - 36744716
Alignment:
| Q |
61 |
tgcatggatggctgatgaggaatttgcaagacagatgattgctggtgtgaatcc |
114 |
Q |
| |
|
|||||||||| ||||||| |||||||||||| | ||| |||||||||| ||||| |
|
|
| T |
36744663 |
tgcatggatgactgatgaagaatttgcaagagaaatgcttgctggtgtaaatcc |
36744716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University