View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15145_high_22 (Length: 236)
Name: NF15145_high_22
Description: NF15145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15145_high_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 33295706 - 33295925
Alignment:
| Q |
1 |
actcaatttatgtgcttcttaaaatgctctgagtggtccccacaattgctaagaagatgttcttgccaatgaattgttctctaaagtgtctttcatgtta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| | |
|
|
| T |
33295706 |
actcaatttatgtgcttcttaaaatgct--gagtggtccccacaattgctaagaagatgttcttgccaatgaattgttctctgaagtgtctttcatgtca |
33295803 |
T |
|
| Q |
101 |
tgatccttcaatattacaaaaaatgaaaagacgtttttgtcactactggagatgctctattactattataagatatattagttgggattaataatc-aac |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
33295804 |
tgatccttcaatattacaaaaaatgaaaagacgtttttgtcactactggagatgctctattactattataagatatattagttgggattaataatcaaac |
33295903 |
T |
|
| Q |
200 |
tttagaaatcctcatcatttct |
221 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
33295904 |
tttagaaatcctcatcatttct |
33295925 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University