View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15145_high_25 (Length: 210)
Name: NF15145_high_25
Description: NF15145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15145_high_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 15 - 193
Target Start/End: Complemental strand, 52798091 - 52797909
Alignment:
| Q |
15 |
aaaatcaatgtatttccaaaaatgaatgatgatgcatctctaatttaggaaaacttaggcaaatcatttaatatttattaatgtactacgtataaaatgt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52798091 |
aaaatcaatgtatttccaaaaatgaatgatgatgcatctctaatttaggaaaacttaggcaaatcatttaatatttattaatgtactacgtataaaatgt |
52797992 |
T |
 |
| Q |
115 |
attgtaccttctctc----nnnnnnnnnnnnnttattgtatccaatgacggatctcttcaaagataggcaagagccatggtat |
193 |
Q |
| |
|
|||| |||||||||| |||||||||||| |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
52797991 |
attgaaccttctctcaaaaaaaataaaaaaaattattgtatccagtgacggatctcttcaaagatagacaagagccatggtat |
52797909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University