View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15145_low_1 (Length: 583)
Name: NF15145_low_1
Description: NF15145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15145_low_1 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 228; Significance: 1e-125; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 228; E-Value: 1e-125
Query Start/End: Original strand, 86 - 448
Target Start/End: Complemental strand, 17681957 - 17681590
Alignment:
| Q |
86 |
gcctgtcggagaagatcggagagtttctccactttggatttgatgtccacacattcttgcttgaacgggattgcctcctctgctgctttcgctactttgt |
185 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||||| |||| ||| |||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
17681957 |
gcctgccgtagaagatcggagagtttctccactttggatctgatatccccacattcttgtttgaacgggattgccttctctgctgctttcgctactttgt |
17681858 |
T |
|
| Q |
186 |
cggccagctggatcaactttgctagtttttgtttcactacatcattgttttcacccatttgaatttgtt-----gatacaaagagtatattcaaatgcgt |
280 |
Q |
| |
|
|||||||||||| ||| |||||||| || |||||| || |||||||| ||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
17681857 |
cggccagctggaccaaatttgctagcattcgtttcaaagaataattgtttttacccatttgaatttgatttgatgatacaaagagtatattcaaatgcgt |
17681758 |
T |
|
| Q |
281 |
attctaattctcctactgcctaacacttcttcttttatcatcggattaagcttcaacggataaaacattcttagccacacatagctttactcagtctagt |
380 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||| |||||||||||| | |
|
|
| T |
17681757 |
attctaattctcctactgcctaacacttcttcttttatcatcggattaagctgcaacggacaaaacattcttagccacacatagccttactcagtctaat |
17681658 |
T |
|
| Q |
381 |
caaaccgcgtactttgtccaccagctcgatcgaacctgctagtaattgcttcacagattcgttacccc |
448 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||| |||| |||||||||||||| |||||||||||| |
|
|
| T |
17681657 |
caaaccgcgtactttgtccgacagctgaatcgaacatgcttgtaattgcttcacatattcgttacccc |
17681590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 66; E-Value: 7e-29
Query Start/End: Original strand, 479 - 560
Target Start/End: Complemental strand, 17681470 - 17681389
Alignment:
| Q |
479 |
gggttaagctgcgcaacagacaaaacatgtctttttcttactctctgttttattcaccttgctttttctgttcactttcctc |
560 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
17681470 |
gggttaagcttcgcagcagacaaaacatgtctttttcttactctttgttttattcaccttgctttttctgttccctttcctc |
17681389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University