View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15145_low_11 (Length: 338)
Name: NF15145_low_11
Description: NF15145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15145_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 78; Significance: 3e-36; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 241 - 326
Target Start/End: Complemental strand, 55694372 - 55694287
Alignment:
| Q |
241 |
ctgtggccacttggaagaatctttttcaagcagacacctcatgtcactgacagaaattaaagagatcaatgtacccagtataatat |
326 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
55694372 |
ctgtggccacttggaagaatctttttcaagcagacacctcatgtcactgacagaaattaaagagatcaatgtacccaaaataatat |
55694287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 80 - 147
Target Start/End: Complemental strand, 55694549 - 55694483
Alignment:
| Q |
80 |
gagactatatctttgaattacctcaacagtggccatttgggaatggaaagatgaattacaaaagaaat |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
55694549 |
gagactatatctttgaattacctcaacagtggccattt-ggaatggaaagaggaattacaaaagaaat |
55694483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 55694602 - 55694565
Alignment:
| Q |
1 |
ttgtatgatacttctgtattacaaattatgtaatgcat |
38 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
55694602 |
ttgtatgatacttctgtattacaaattaggtaatgcat |
55694565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University