View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15145_low_14 (Length: 270)
Name: NF15145_low_14
Description: NF15145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15145_low_14 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 149; Significance: 9e-79; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 149; E-Value: 9e-79
Query Start/End: Original strand, 114 - 270
Target Start/End: Original strand, 39209926 - 39210082
Alignment:
| Q |
114 |
ttgaagccaaattgcaaaaaagaaatgggtgaatgtttacaacatataatctagatctttaagggtgagtaatggaccagaccaccaacacgaatactga |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
39209926 |
ttgaagccaaattgcaaaaaagaaatgggtgaatgtttacaacatataatctagatctttaaggatgaataatggaccagaccaccaacacgaatactga |
39210025 |
T |
 |
| Q |
214 |
tccacatcctacaactcagtgcatcaaatcaaaaacctttacggtcatttctagcca |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39210026 |
tccacatcctacaactcagtgcatcaaatcaaaaacctttacggtcatttctagcca |
39210082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University