View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15145_low_19 (Length: 242)
Name: NF15145_low_19
Description: NF15145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15145_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 20 - 225
Target Start/End: Complemental strand, 55694894 - 55694690
Alignment:
| Q |
20 |
ttcataattcatatgtcttatcttcaaataacttgatagatatttttgattgaagttctgctttaaataacaataatacaatgtagtagaatcaattaan |
119 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||| | ||| || |||||||||||||||||||||||| |
|
|
| T |
55694894 |
ttcataattcatatgtcttatattcaaataacttgatagatatttttgattgaagtgctgcttctagtaataaaaatacaatgtagtagaatcaatta-t |
55694796 |
T |
 |
| Q |
120 |
nnnnnnaagagcaaattgattattgatcttttttggattatgaaaaataaacacagggaaagagatctacactaatttgttgtttataatccattggact |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55694795 |
tttttcaagagcaaattgattattgatcttttttggattatgaaaaataaacacagggaaagagatctacactaatttgttgtttataatccattggact |
55694696 |
T |
 |
| Q |
220 |
aatatt |
225 |
Q |
| |
|
|||||| |
|
|
| T |
55694695 |
aatatt |
55694690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University