View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15145_low_21 (Length: 237)

Name: NF15145_low_21
Description: NF15145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15145_low_21
NF15145_low_21
[»] chr8 (10 HSPs)
chr8 (17-237)||(6370452-6370672)
chr8 (23-114)||(6391485-6391576)
chr8 (23-114)||(6410647-6410738)
chr8 (61-141)||(7459633-7459713)
chr8 (61-114)||(6363676-6363729)
chr8 (64-114)||(6289528-6289578)
chr8 (65-114)||(6321910-6321959)
chr8 (61-114)||(6332484-6332537)
chr8 (65-114)||(6424567-6424616)
chr8 (23-111)||(6352874-6352962)
[»] chr3 (1 HSPs)
chr3 (61-114)||(36744663-36744716)


Alignment Details
Target: chr8 (Bit Score: 221; Significance: 1e-122; HSPs: 10)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 17 - 237
Target Start/End: Complemental strand, 6370672 - 6370452
Alignment:
17 atggattcttttgaaaatttgttactatgagtagaggattatcatgcatggatggctgatgaggaatttgcaagacagatgattgctggtgtgaatccga 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6370672 atggattcttttgaaaatttgttactatgagtagaggattatcatgcatggatggctgatgaggaatttgcaagacagatgattgctggtgtgaatccga 6370573  T
117 atgccatcgaaaaacttctggtaaatttgtaatatttttaagcatgtacaaaagaaataaagaaggttatcatttcaacttttcatatataatacataca 216  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6370572 atgccatcgaaaaacttctggtaaatttgtaatatttttaagcatgtacaaaagaaataaagaaggttatcatttcaacttttcatatataatacataca 6370473  T
217 tagtaatttgtaattaacctc 237  Q
    |||||||||||||||||||||    
6370472 tagtaatttgtaattaacctc 6370452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 23 - 114
Target Start/End: Complemental strand, 6391576 - 6391485
Alignment:
23 tcttttgaaaatttgttactatgagtagaggattatcatgcatggatggctgatgaggaatttgcaagacagatgattgctggtgtgaatcc 114  Q
    |||||||||||||| ||||||||||||||||||     |||||||||| |||||||||||||||||||  ||||||||||||||||||||||    
6391576 tcttttgaaaatttcttactatgagtagaggatcgcactgcatggatgactgatgaggaatttgcaagggagatgattgctggtgtgaatcc 6391485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 23 - 114
Target Start/End: Complemental strand, 6410738 - 6410647
Alignment:
23 tcttttgaaaatttgttactatgagtagaggattatcatgcatggatggctgatgaggaatttgcaagacagatgattgctggtgtgaatcc 114  Q
    |||||||||||||| ||||||||||||||||||     |||||||||| ||||||||||||| |||||| |||| |||||||||||||||||    
6410738 tcttttgaaaatttcttactatgagtagaggatcgcactgcatggatgactgatgaggaattcgcaagagagataattgctggtgtgaatcc 6410647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 61 - 141
Target Start/End: Complemental strand, 7459713 - 7459633
Alignment:
61 tgcatggatggctgatgaggaatttgcaagacagatgattgctggtgtgaatccgaatgccatcgaaaaacttctggtaaa 141  Q
    |||||||||| ||||||||||||| ||||| |||||||||||||| ||||||||  ||  |||| ||||||||||||||||    
7459713 tgcatggatgactgatgaggaattcgcaaggcagatgattgctggggtgaatcctcatatcatcaaaaaacttctggtaaa 7459633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 61 - 114
Target Start/End: Complemental strand, 6363729 - 6363676
Alignment:
61 tgcatggatggctgatgaggaatttgcaagacagatgattgctggtgtgaatcc 114  Q
    |||||||||| |||||||||||||||||||  ||||||||||||| ||||||||    
6363729 tgcatggatgactgatgaggaatttgcaagggagatgattgctggggtgaatcc 6363676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 64 - 114
Target Start/End: Complemental strand, 6289578 - 6289528
Alignment:
64 atggatggctgatgaggaatttgcaagacagatgattgctggtgtgaatcc 114  Q
    ||||||| ||||||| |||||| ||||| ||||||||||||||||||||||    
6289578 atggatgactgatgaagaatttacaagagagatgattgctggtgtgaatcc 6289528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 65 - 114
Target Start/End: Complemental strand, 6321959 - 6321910
Alignment:
65 tggatggctgatgaggaatttgcaagacagatgattgctggtgtgaatcc 114  Q
    |||||| ||||||| |||||||||||  ||||||||||||||||||||||    
6321959 tggatgactgatgaagaatttgcaagggagatgattgctggtgtgaatcc 6321910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 61 - 114
Target Start/End: Complemental strand, 6332537 - 6332484
Alignment:
61 tgcatggatggctgatgaggaatttgcaagacagatgattgctggtgtgaatcc 114  Q
    |||||||||| ||||||  |||||||||||  ||||||||||||||||||||||    
6332537 tgcatggatgactgatggagaatttgcaagggagatgattgctggtgtgaatcc 6332484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 65 - 114
Target Start/End: Complemental strand, 6424616 - 6424567
Alignment:
65 tggatggctgatgaggaatttgcaagacagatgattgctggtgtgaatcc 114  Q
    |||||| |||||||||||||||||||  ||||||||||||| ||||||||    
6424616 tggatgactgatgaggaatttgcaagggagatgattgctggagtgaatcc 6424567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 23 - 111
Target Start/End: Complemental strand, 6352962 - 6352874
Alignment:
23 tcttttgaaaatttgttactatgagtagaggattatcatgcatggatggctgatgaggaatttgcaagacagatgattgctggtgtgaa 111  Q
    |||||||||||||| ||| |||||  || |||  ||  |||||||  | |||||||||||||||||||  ||||||||||||| |||||    
6352962 tcttttgaaaatttcttaatatgaacagtggaccattctgcatggcagactgatgaggaatttgcaagggagatgattgctggggtgaa 6352874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 61 - 114
Target Start/End: Original strand, 36744663 - 36744716
Alignment:
61 tgcatggatggctgatgaggaatttgcaagacagatgattgctggtgtgaatcc 114  Q
    |||||||||| ||||||| |||||||||||| | ||| |||||||||| |||||    
36744663 tgcatggatgactgatgaagaatttgcaagagaaatgcttgctggtgtaaatcc 36744716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University