View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15146_high_22 (Length: 254)
Name: NF15146_high_22
Description: NF15146
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15146_high_22 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 16 - 134
Target Start/End: Original strand, 6495743 - 6495861
Alignment:
| Q |
16 |
gttcttgcttgtgggaggcttgcaagtgttttgttccttttgctgtctgatttttggcagtcgtgttgctgctactgtgatgcagcctgcgcttttggcc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
6495743 |
gttcttgcttgtgggaggcttgcaagtgttttgttccttttgctgtctgattgttggcagtcgtgttgctgttactgtgatgcagcctgcacttttggcc |
6495842 |
T |
|
| Q |
116 |
tgtagctgttacatattca |
134 |
Q |
| |
|
|||||||||||||| |||| |
|
|
| T |
6495843 |
tgtagctgttacattttca |
6495861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 169 - 244
Target Start/End: Original strand, 6495896 - 6495971
Alignment:
| Q |
169 |
agtcctctccgtgttggatttggactcttaggggttttttgatcgagtttgtttgtagtagtgtgctgcggtctgt |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
6495896 |
agtcctctccgtgttggatttggactcttagggggttttttatcgagtttgtttgtagtagtgtgctgcggtctgt |
6495971 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University