View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15146_high_30 (Length: 214)
Name: NF15146_high_30
Description: NF15146
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15146_high_30 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 1 - 199
Target Start/End: Original strand, 50871504 - 50871708
Alignment:
| Q |
1 |
gttcatcctttattcctttcttgttctgcagcagatcatgctgcagatcatgctgatcacccatggtattggcattg------------gcattggcatt |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
50871504 |
gttcatcctttattcctttcttgttctgcagcag------ctgcagatcatgctgatcacccatggtattggtattggtattggtattggcattggcatt |
50871597 |
T |
|
| Q |
89 |
gagctgtacatagtcataaaagcagtacggttttgttactgcatcatcacatattcttcttctttcactgctgcattgcagactatttgtagaacttctc |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
50871598 |
gagctgtacatagtcataaaagcagtacggttttgttaccgcatcatcacatattcttcttctttcactgctgcattgcagactagttgtagaacttctc |
50871697 |
T |
|
| Q |
189 |
ctctcgattct |
199 |
Q |
| |
|
||||||||||| |
|
|
| T |
50871698 |
ctctcgattct |
50871708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University