View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15146_low_15 (Length: 330)
Name: NF15146_low_15
Description: NF15146
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15146_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 7e-80; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 7e-80
Query Start/End: Original strand, 1 - 151
Target Start/End: Complemental strand, 15454878 - 15454728
Alignment:
| Q |
1 |
gactatcacatagcagtggacctcttaatggatctttaacagatagtccaccagtttcaccttctgaaatggatgatttcaaggtacatacatctttctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15454878 |
gactatcacatagcagtggacctcttaatggatctttaacagatagtccaccagtttcaccttctgaaatggatgatttcaaggtacatacatctttctt |
15454779 |
T |
 |
| Q |
101 |
aatttcataggtggctttaatttgacattaaaaaccttaacaaacaaccat |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15454778 |
aatttcataggtggctttaatttgacattaaaaaccttaacaaacaaccat |
15454728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 192 - 313
Target Start/End: Complemental strand, 15454687 - 15454566
Alignment:
| Q |
192 |
ggtacaaagcacgaaacactgatctcactgtacagtgtacagttagaaaccactagtaccaatttcagctttctctgttaccaacaaacataaattggat |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15454687 |
ggtacaaagcacgaaacactgatctcactgtacagtgtacagttagaaaccactagtaccaatttcagctttctctgttaccaacaaacataaattggat |
15454588 |
T |
 |
| Q |
292 |
gacacccagagacagtaataat |
313 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
15454587 |
gacacccagagacagtaataat |
15454566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University