View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15146_low_29 (Length: 242)
Name: NF15146_low_29
Description: NF15146
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15146_low_29 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 18 - 220
Target Start/End: Original strand, 11101917 - 11102118
Alignment:
| Q |
18 |
acaactttgtgtgggaggttgtggtaaccatgaagatgcggaccatcgattcttgtgatgtgannnnnnnngtgaaagattttagtcattggtttcacat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
11101917 |
acaactttgtgtgggaggttgtggtaaccatgaagatgcgggccatcgattcttgtgatgtgatttttttt-tgaaagattttagtcattggtttcacat |
11102015 |
T |
 |
| Q |
118 |
tggagatgtttcgatgcggtgaatttggcgcgcctcatgtatcatttaattcaatttagacatataggaggatgctctaagaattctagatcggctttac |
217 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11102016 |
tggatatgtttcgatgcggtgaatttggcgtgcctcatgtatcatttaattcaatttagacatataggaggatgctctaagaattctagatcggctttac |
11102115 |
T |
 |
| Q |
218 |
atc |
220 |
Q |
| |
|
||| |
|
|
| T |
11102116 |
atc |
11102118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University