View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15146_low_34 (Length: 214)

Name: NF15146_low_34
Description: NF15146
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15146_low_34
NF15146_low_34
[»] chr1 (1 HSPs)
chr1 (1-199)||(50871504-50871708)


Alignment Details
Target: chr1 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 1 - 199
Target Start/End: Original strand, 50871504 - 50871708
Alignment:
1 gttcatcctttattcctttcttgttctgcagcagatcatgctgcagatcatgctgatcacccatggtattggcattg------------gcattggcatt 88  Q
    ||||||||||||||||||||||||||||||||||      |||||||||||||||||||||||||||||||| ||||            |||||||||||    
50871504 gttcatcctttattcctttcttgttctgcagcag------ctgcagatcatgctgatcacccatggtattggtattggtattggtattggcattggcatt 50871597  T
89 gagctgtacatagtcataaaagcagtacggttttgttactgcatcatcacatattcttcttctttcactgctgcattgcagactatttgtagaacttctc 188  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
50871598 gagctgtacatagtcataaaagcagtacggttttgttaccgcatcatcacatattcttcttctttcactgctgcattgcagactagttgtagaacttctc 50871697  T
189 ctctcgattct 199  Q
    |||||||||||    
50871698 ctctcgattct 50871708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University