View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15148_high_32 (Length: 223)
Name: NF15148_high_32
Description: NF15148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15148_high_32 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 94; Significance: 5e-46; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 12 - 121
Target Start/End: Complemental strand, 17136357 - 17136248
Alignment:
| Q |
12 |
aagaatatgtatcgggaagattctgcatatttcatacaaaaacagcaaatagagacaatcaagcagcccctctttcttaaattttcatctgtggggagct |
111 |
Q |
| |
|
||||| |||| | |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17136357 |
aagaaaatgtgttgggaagattctgcagatttcatacaaaaacagcaaatagagacaatcaagcagcccctctttcttaaattttcatctgtggggagct |
17136258 |
T |
 |
| Q |
112 |
tgttgtgaag |
121 |
Q |
| |
|
|||||||||| |
|
|
| T |
17136257 |
tgttgtgaag |
17136248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 120 - 205
Target Start/End: Complemental strand, 17136132 - 17136047
Alignment:
| Q |
120 |
agatcaccatcagatgcagaattctagcataacttgtcctgcatatcagaagaaggcagactgatattgtggatttgagcagttag |
205 |
Q |
| |
|
||||| ||||||| ||||| |||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
17136132 |
agatccccatcagctgcagtattccagcataacttgtcctgcatatcagaagaaggcagggtgatattgtggatttgagcagttag |
17136047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 94; Significance: 5e-46; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 12 - 121
Target Start/End: Original strand, 6937300 - 6937409
Alignment:
| Q |
12 |
aagaatatgtatcgggaagattctgcatatttcatacaaaaacagcaaatagagacaatcaagcagcccctctttcttaaattttcatctgtggggagct |
111 |
Q |
| |
|
||||| |||| | |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6937300 |
aagaaaatgtgttgggaagattctgcagatttcatacaaaaacagcaaatagagacaatcaagcagcccctctttcttaaattttcatctgtggggagct |
6937399 |
T |
 |
| Q |
112 |
tgttgtgaag |
121 |
Q |
| |
|
|||||||||| |
|
|
| T |
6937400 |
tgttgtgaag |
6937409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 49 - 113
Target Start/End: Original strand, 24718322 - 24718386
Alignment:
| Q |
49 |
aaaaacagcaaatagagacaatcaagcagcccctctttcttaaattttcatctgtggggagcttg |
113 |
Q |
| |
|
||||||| |||||||||||||| | || || || |||||||| ||||||||||||||||||||| |
|
|
| T |
24718322 |
aaaaacaacaaatagagacaattatacaacctctatttcttaagttttcatctgtggggagcttg |
24718386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 48 - 112
Target Start/End: Original strand, 25639126 - 25639190
Alignment:
| Q |
48 |
caaaaacagcaaatagagacaatcaagcagcccctctttcttaaattttcatctgtggggagctt |
112 |
Q |
| |
|
|||||||| |||| ||| ||||| | |||||||||||| | |||||||||||||| |||||||| |
|
|
| T |
25639126 |
caaaaacaacaaacagacacaataatgcagcccctcttacgcaaattttcatctgttgggagctt |
25639190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University