View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15148_low_19 (Length: 330)
Name: NF15148_low_19
Description: NF15148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15148_low_19 |
 |  |
|
| [»] scaffold0154 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0154 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: scaffold0154
Description:
Target: scaffold0154; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 67 - 311
Target Start/End: Original strand, 22357 - 22601
Alignment:
| Q |
67 |
aggattctaaatccaacctctacatataatatgcaatacttataccaactaaattaaatttacaagacaatataaatatttttctaatagaatggaatga |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
22357 |
aggattctaaatccaacctctacatataatatgcaatactcataccaactaaattaaattcacaagacagtataaatatttttctaatagactggaatga |
22456 |
T |
 |
| Q |
167 |
agatatttctgcacctacaccatcttttcttttctcatgctttgtataattcataccaaacgcggtttcccctcttaatttaaatcttgttatagtaatc |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22457 |
agatatttctgcacctacaccatcttttcttttctcatgctttgtataattcataccaaacgcggtttcccctcttaatttaaatcttgttatagtaatc |
22556 |
T |
 |
| Q |
267 |
ttatacctatgcctttcccaagtgaataaactctagaatactttg |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22557 |
ttatacctatgcctttcccaagtgaataaactctagaatactttg |
22601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University