View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15148_low_21 (Length: 312)
Name: NF15148_low_21
Description: NF15148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15148_low_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 4 - 296
Target Start/End: Original strand, 10421128 - 10421423
Alignment:
| Q |
4 |
attctgaatatcatcagttagtttaagtgggtggcagcctcattaatgtaaaggctcaacttacaccatctaaactactctatacattgttgtaatctct |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10421128 |
attctgaatatcatcagttagtttaagtgggtggcagcctcattaatgtaaaggctcaacttacaccatctaaactactctatacattgttgtaatctct |
10421227 |
T |
 |
| Q |
104 |
aacatatgaatatccagatgacaagtaattcatctttttct--ttactagnnnnnnnctttctcttataatttgggtgggatt-gatagataataaaata |
200 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| ||| ||||||| |||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
10421228 |
aacatatgcatatccagatgacaagtaattcatctttctctctttactagtttttttctttctcttataatttgggtgggatttgttagataataaaata |
10421327 |
T |
 |
| Q |
201 |
ttgagtttaagctattagttcttggaaatctatgttatgcagtgctattgtaatattattgatattttgtgaacccttaaccgtctttgttagtat |
296 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
10421328 |
ttgagtttaaactattagttctttgaaatctatgttatgcagtgctattgtaatattattgatattttatgaacccttaaccgtctttgttagtat |
10421423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University