View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15148_low_24 (Length: 287)
Name: NF15148_low_24
Description: NF15148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15148_low_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 47 - 271
Target Start/End: Original strand, 42158602 - 42158826
Alignment:
| Q |
47 |
ctgtctctaagtttatatgttatttcaactttttcaagcaatgattatcatgattcatgaatgatgttgctatgataatagattatcaacgtggattctc |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42158602 |
ctgtctctaagtttatatgttatttcaactttttcaagcaatgattatcatgattcatgaatgatgttgctatgataatagattatcaacgtggattctc |
42158701 |
T |
 |
| Q |
147 |
tcttttggtttgtccatccaaacagtaattagccgttggacattgagcaacaaccaaccatggtttgacaaaccacctgtcgcagtaagtcagaccacta |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
42158702 |
tcttttggtttgtccatccaaacagtaattagccgttggacattgaccaacaaccaaccatggtttgacaaaccacctatcgtagtaagtcagaccacta |
42158801 |
T |
 |
| Q |
247 |
atttctaagaaatctatgtggtttg |
271 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
42158802 |
atttctaagaaatctatgtggtttg |
42158826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University