View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15148_low_37 (Length: 217)
Name: NF15148_low_37
Description: NF15148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15148_low_37 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 44; Significance: 3e-16; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 155 - 198
Target Start/End: Original strand, 25868639 - 25868682
Alignment:
| Q |
155 |
ttccacggtgttgaaatataagctaaaatatagatggttattaa |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25868639 |
ttccacggtgttgaaatataagctaaaatatagatggttattaa |
25868682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 155 - 198
Target Start/End: Complemental strand, 25867472 - 25867429
Alignment:
| Q |
155 |
ttccacggtgttgaaatataagctaaaatatagatggttattaa |
198 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
25867472 |
ttccacggtgttgaaatataaggtaaaatatagatggttattaa |
25867429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 18 - 64
Target Start/End: Complemental strand, 25867608 - 25867563
Alignment:
| Q |
18 |
tactaaaccgaaaatgggtggaatgcaaaataaacggctcttttctt |
64 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
25867608 |
tactaaaccgaaaatggg-ggaatgcaaaataaacggctcttttctt |
25867563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 29 - 61
Target Start/End: Original strand, 25868513 - 25868545
Alignment:
| Q |
29 |
aaatgggtggaatgcaaaataaacggctctttt |
61 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
25868513 |
aaatggggggaatgcaaaataaacggctctttt |
25868545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University