View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1514_low_15 (Length: 201)
Name: NF1514_low_15
Description: NF1514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1514_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 199
Target Start/End: Complemental strand, 27313414 - 27313216
Alignment:
| Q |
1 |
aaaagtgatccaatcattaataaggaaaaaactttggatctccaaaatactaatgaagtaacaaatcgaggaattgggaaaagatcataaaatacgagtc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
27313414 |
aaaagtgatccaatcattaataaggaaaaaactttggatctccaaaatgctaatgaagtaacaaatcgaggaattgggcaaagatcataaaataggagtc |
27313315 |
T |
 |
| Q |
101 |
ttaaaagtttcaaaattttgaataaaccaaatctacattaagctctcaaataaatcttacatatattttcttaattatgtaaaaacatatacatgaaca |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27313314 |
ttaaaagtttcaaaattttgaataaaccaaatctacattaagctctcaaataaatcttacatatattttcttaattatgtaaaaacatatacatgaaca |
27313216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University