View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1514_low_8 (Length: 316)
Name: NF1514_low_8
Description: NF1514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1514_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 42 - 225
Target Start/End: Original strand, 36465269 - 36465452
Alignment:
| Q |
42 |
cttggtgctgctgtcattatggggactaatgaacaaatacttcctttcttcactcagttccttcagtttcatgctcaatgggatgattttccaatgttta |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36465269 |
cttggtgctgctgtcattatggggactaatgaacaaatacttcctttcttcactcagttccttcagtttcatgctcaatgggatgattttccaatgttta |
36465368 |
T |
|
| Q |
142 |
agtaagttcattttacataacggtgatgtcccactttattgtatttttggtcctcctattttaacttaaacacaattttagatc |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
36465369 |
agtaagttcattttacataacggtgatgtcccactttcttgtatttttggtcctcctatcttaactgaaacacaattttagatc |
36465452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University