View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15151_high_4 (Length: 223)
Name: NF15151_high_4
Description: NF15151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15151_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 87; Significance: 7e-42; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 19 - 182
Target Start/End: Complemental strand, 23095023 - 23094860
Alignment:
| Q |
19 |
cttttatcggaagcctaaagcaatggatttagtagctttacccttagtacgacctaactnnnnnnngaaggatcatgacaacttaagtttgtatttagtt |
118 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||||||||| ||||||| ||| |||| |||||||||||| ||||| | ||||||| |||| |
|
|
| T |
23095023 |
cttttatcggaagcctaaagcgatgggtttagtagctttacctttagtacaacccaactaaaaat-gaaggatcatgataactttaagttgtattgagtt |
23094925 |
T |
 |
| Q |
119 |
tgaatttaagattgtttgagtaattggacaaa-cgggagtatggaaaatgacaacaacggaaaaa |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
23094924 |
tgaatttaagattgtttgagtaattggacaaaccgggagtatggaaaatgaaaacaacggaaaaa |
23094860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University