View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15152_high_1 (Length: 381)
Name: NF15152_high_1
Description: NF15152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15152_high_1 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 295; Significance: 1e-165; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 295; E-Value: 1e-165
Query Start/End: Original strand, 1 - 328
Target Start/End: Original strand, 36565072 - 36565402
Alignment:
| Q |
1 |
tgtttgtccctctactctcttttgtgcctttggattcaatgtttggttttgcaatacacaaagagacttgtttttggttgaatcaactgttgcttgattt |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36565072 |
tgtttgtccctctactctcttgtgtgcctttggattcaatgtttggttttgcaatacacaaagagacttgtttttggttgaatcaactgttgcttgattt |
36565171 |
T |
 |
| Q |
101 |
gtttagcttgactgtcattgatatttgccttgcacatcattgtcttggtgggacttgattgaaatcacaacaattagaacaattttttcattatatcatt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36565172 |
gtttagcttgactgtcattgatatttgccttgcacatcattgtcttggtcggacttgattgaaatcacaacaattagaacaattttttcattatatcatt |
36565271 |
T |
 |
| Q |
201 |
gatgttatcgtgaac----tcccctgtattatccgtctaaatcaaatcatttgcaagggggtggtggcaagctgcttctctacatggccggtccgtaagt |
296 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36565272 |
gatgttatcgtgaactcgatcccatgtattatccgtctaaatcaaatcatttgcaa-ggggtggtggcaagctgcttctctacatggccggtccgtaagt |
36565370 |
T |
 |
| Q |
297 |
aagaccactaaagtccttgttttaggcctacc |
328 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
36565371 |
aagaccactaaagtccttgttttaggcctacc |
36565402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University