View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15154_low_4 (Length: 234)
Name: NF15154_low_4
Description: NF15154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15154_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 18 - 220
Target Start/End: Complemental strand, 36058565 - 36058366
Alignment:
| Q |
18 |
gtttgagtcttatttaatttacatatacaatttattttttgaagaagccaaactatgcagatacaaattattgtgcatgtctttatggttatttgtcaac |
117 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
36058565 |
gtttgagtcttatttaatttacatatataatttattttttgaagaagccaaactatgcagatacaaattattgtgcatgtctctatggttatttgtcaac |
36058466 |
T |
|
| Q |
118 |
gtgcctagttactaatgttattgtatgtttttgttctcttcttttaatagttgttgctgctacagctgccaactttgatgctcaaattaacattgcccct |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36058465 |
gtgcctagttactaatgttattgtatgtttttgttctcttcttt---tagttgttgctgctacagctgccaactttgatgctcaaattaacattgcccct |
36058369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 127 - 209
Target Start/End: Original strand, 28723298 - 28723378
Alignment:
| Q |
127 |
tactaatgttattgtatgttt-ttgttctcttcttttaatagttgttgctgctacagctgccaactttgatgctcaaattaaca |
209 |
Q |
| |
|
|||||| ||| |||||||||| |||||||||||||||| |||| |||||| || ||| |||| |||| |||||||||||||| |
|
|
| T |
28723298 |
tactaaagttgttgtatgtttgttgttctcttctttta---gttgctgctgccaccgctcccaattttgctgctcaaattaaca |
28723378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University