View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15155_low_8 (Length: 217)
Name: NF15155_low_8
Description: NF15155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15155_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 18 - 204
Target Start/End: Original strand, 49265575 - 49265761
Alignment:
| Q |
18 |
caataaccatatgttcccactacttgtgtggatacatgagtcatatcaccaattggtccaagttttgcaaacccaaaatctgataacttggcatgataat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
49265575 |
caataaccatatgttcccactacttgtgtggatacatgagtcatatcaccaattggtccaagttttgcgaacccaaaatctgataacttggcatcataat |
49265674 |
T |
 |
| Q |
118 |
tttcaccgagaaggacgttggatgactttaagtctctatatatcacagggggatttgccttatgcatatattccaacccctttgcta |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49265675 |
tttcaccgagaaggacgttggatgactttaagtctctatatatcacagggggatttgccttatgcatatattccaacccctttgcta |
49265761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 18 - 203
Target Start/End: Complemental strand, 6603711 - 6603523
Alignment:
| Q |
18 |
caataaccatatgttcccactacttgtgtggatacatgagtcatatcaccaattggtccaagttttgcaaacccaaaatctgataacttggcatgataat |
117 |
Q |
| |
|
||||| ||||||||||||| ||| ||||||||||||||||| ||||||||| ||| ||||||||||| | |||||||||||||||||||| |||| || |
|
|
| T |
6603711 |
caatagccatatgttcccattacacgtgtggatacatgagtcttatcaccaactggaccaagttttgccagcccaaaatctgataacttgggatgaaaac |
6603612 |
T |
 |
| Q |
118 |
tttcaccgagaaggacgttggatgactttaagtctctatatatcacagggggatttgcctt---atgcatatattccaacccctttgct |
203 |
Q |
| |
|
|||| | || |||| ||| ||||| |||||||||||||| |||||||||||||||||||| ||||| |||||||| ||||||||| |
|
|
| T |
6603611 |
cttcatctaggaggatgttagatgattttaagtctctatagatcacagggggatttgccttgtcatgcaagtattccaatccctttgct |
6603523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 24 - 117
Target Start/End: Complemental strand, 40923901 - 40923808
Alignment:
| Q |
24 |
ccatatgttcccactacttgtgtggatacatgagtcatatcaccaattggtccaagttttgcaaacccaaaatctgataacttggcatgataat |
117 |
Q |
| |
|
||||||||||||| ||| ||| || ||||||||||||||||| ||||| || | |||||| || |||||||| |||||||||| |||||||| |
|
|
| T |
40923901 |
ccatatgttcccataactcttgttgaaacatgagtcatatcaccgattggacctacttttgccaagccaaaatcggataacttgggatgataat |
40923808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 18 - 117
Target Start/End: Complemental strand, 13172449 - 13172350
Alignment:
| Q |
18 |
caataaccatatgttcccactacttgtgtggatacatgagtcatatcaccaattggtccaagttttgcaaacccaaaatctgataacttggcatgataat |
117 |
Q |
| |
|
||||| ||||||||||||| ||| ||| || ||||||||| ||||||||||||| || | |||||| || || ||||| |||||||||| |||||||| |
|
|
| T |
13172449 |
caatacccatatgttcccattacccttgttgacacatgagtcttatcaccaattggacctacttttgccaagccgaaatcagataacttgggatgataat |
13172350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University