View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15156_high_12 (Length: 249)
Name: NF15156_high_12
Description: NF15156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15156_high_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 5 - 240
Target Start/End: Complemental strand, 21400523 - 21400288
Alignment:
| Q |
5 |
cttgatagtggggaaacatatcacatatgtttttacatggatgtgtttcatttcttataaaagaattaaaggaacacaagttaagttgtctaatggtaat |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21400523 |
cttgatagtggggaaacatatcacatatgtttttacatggatgtgtttcatttcttataaaagaattaaaggaacacaagttaagttgtctaatggtaat |
21400424 |
T |
|
| Q |
105 |
tatgcaatggcagaaatggttggaattgtgcatatcattagctccatagttctacatgatgtgttatacttgccagtttcttaatgtcaatttgatattc |
204 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
21400423 |
tatgcaatagcagaaatggttggaattgtgcatatcattagctccatagttctacatgatgtgttatacttgccagtttcttattgtcaatttgatattc |
21400324 |
T |
|
| Q |
205 |
atagacaaggtagcaaaggaattgtcttgttctctg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
21400323 |
atagacaaggtagcaaaggaattgtcttgttctctg |
21400288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University